ID: 1185909967

View in Genome Browser
Species Human (GRCh38)
Location X:3972196-3972218
Sequence AAGGGCCTGTTAAACTCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185909959_1185909967 9 Left 1185909959 X:3972164-3972186 CCCTCCAAGTGCATGGAGCATTA 0: 11
1: 17
2: 29
3: 36
4: 107
Right 1185909967 X:3972196-3972218 AAGGGCCTGTTAAACTCTGGGGG No data
1185909961_1185909967 5 Left 1185909961 X:3972168-3972190 CCAAGTGCATGGAGCATTATATA 0: 11
1: 8
2: 11
3: 17
4: 128
Right 1185909967 X:3972196-3972218 AAGGGCCTGTTAAACTCTGGGGG No data
1185909960_1185909967 8 Left 1185909960 X:3972165-3972187 CCTCCAAGTGCATGGAGCATTAT 0: 11
1: 19
2: 26
3: 38
4: 114
Right 1185909967 X:3972196-3972218 AAGGGCCTGTTAAACTCTGGGGG No data
1185909957_1185909967 18 Left 1185909957 X:3972155-3972177 CCTTTCTAACCCTCCAAGTGCAT 0: 7
1: 12
2: 30
3: 23
4: 150
Right 1185909967 X:3972196-3972218 AAGGGCCTGTTAAACTCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185909967 Original CRISPR AAGGGCCTGTTAAACTCTGG GGG Intergenic
No off target data available for this crispr