ID: 1185912751

View in Genome Browser
Species Human (GRCh38)
Location X:4000434-4000456
Sequence TCTGGCAAACCCTATGGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185912745_1185912751 19 Left 1185912745 X:4000392-4000414 CCAGTCTTTGATGAAAATAACCC No data
Right 1185912751 X:4000434-4000456 TCTGGCAAACCCTATGGTGTTGG No data
1185912747_1185912751 -1 Left 1185912747 X:4000412-4000434 CCCTGTCACGTAGGTAAAATAAT No data
Right 1185912751 X:4000434-4000456 TCTGGCAAACCCTATGGTGTTGG No data
1185912748_1185912751 -2 Left 1185912748 X:4000413-4000435 CCTGTCACGTAGGTAAAATAATC No data
Right 1185912751 X:4000434-4000456 TCTGGCAAACCCTATGGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185912751 Original CRISPR TCTGGCAAACCCTATGGTGT TGG Intergenic
No off target data available for this crispr