ID: 1185913313

View in Genome Browser
Species Human (GRCh38)
Location X:4006511-4006533
Sequence CTGTGTGTATGTCAGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185913308_1185913313 17 Left 1185913308 X:4006471-4006493 CCTTCACCACAGCATCTACATTA No data
Right 1185913313 X:4006511-4006533 CTGTGTGTATGTCAGGAGGCAGG No data
1185913309_1185913313 11 Left 1185913309 X:4006477-4006499 CCACAGCATCTACATTAGTGTTT No data
Right 1185913313 X:4006511-4006533 CTGTGTGTATGTCAGGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185913313 Original CRISPR CTGTGTGTATGTCAGGAGGC AGG Intergenic
No off target data available for this crispr