ID: 1185914479

View in Genome Browser
Species Human (GRCh38)
Location X:4021035-4021057
Sequence GAAGACGTCACCCTGCTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185914479_1185914482 4 Left 1185914479 X:4021035-4021057 CCATTCAGCAGGGTGACGTCTTC No data
Right 1185914482 X:4021062-4021084 CCTCTGCACCATCCTCATGACGG No data
1185914479_1185914484 12 Left 1185914479 X:4021035-4021057 CCATTCAGCAGGGTGACGTCTTC No data
Right 1185914484 X:4021070-4021092 CCATCCTCATGACGGAGTCCTGG No data
1185914479_1185914487 25 Left 1185914479 X:4021035-4021057 CCATTCAGCAGGGTGACGTCTTC No data
Right 1185914487 X:4021083-4021105 GGAGTCCTGGAGAAAGCCCAGGG No data
1185914479_1185914486 24 Left 1185914479 X:4021035-4021057 CCATTCAGCAGGGTGACGTCTTC No data
Right 1185914486 X:4021082-4021104 CGGAGTCCTGGAGAAAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185914479 Original CRISPR GAAGACGTCACCCTGCTGAA TGG (reversed) Intergenic