ID: 1185914480

View in Genome Browser
Species Human (GRCh38)
Location X:4021057-4021079
Sequence ATGAGGATGGTGCAGAGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185914480_1185914486 2 Left 1185914480 X:4021057-4021079 CCAGTCCTCTGCACCATCCTCAT No data
Right 1185914486 X:4021082-4021104 CGGAGTCCTGGAGAAAGCCCAGG No data
1185914480_1185914484 -10 Left 1185914480 X:4021057-4021079 CCAGTCCTCTGCACCATCCTCAT No data
Right 1185914484 X:4021070-4021092 CCATCCTCATGACGGAGTCCTGG No data
1185914480_1185914487 3 Left 1185914480 X:4021057-4021079 CCAGTCCTCTGCACCATCCTCAT No data
Right 1185914487 X:4021083-4021105 GGAGTCCTGGAGAAAGCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185914480 Original CRISPR ATGAGGATGGTGCAGAGGAC TGG (reversed) Intergenic