ID: 1185914481

View in Genome Browser
Species Human (GRCh38)
Location X:4021062-4021084
Sequence CCGTCATGAGGATGGTGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185914481_1185914491 26 Left 1185914481 X:4021062-4021084 CCTCTGCACCATCCTCATGACGG No data
Right 1185914491 X:4021111-4021133 TCAATTCCCAAGTGTCATCTTGG No data
1185914481_1185914487 -2 Left 1185914481 X:4021062-4021084 CCTCTGCACCATCCTCATGACGG No data
Right 1185914487 X:4021083-4021105 GGAGTCCTGGAGAAAGCCCAGGG No data
1185914481_1185914486 -3 Left 1185914481 X:4021062-4021084 CCTCTGCACCATCCTCATGACGG No data
Right 1185914486 X:4021082-4021104 CGGAGTCCTGGAGAAAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185914481 Original CRISPR CCGTCATGAGGATGGTGCAG AGG (reversed) Intergenic