ID: 1185914483

View in Genome Browser
Species Human (GRCh38)
Location X:4021070-4021092
Sequence CCAGGACTCCGTCATGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185914483_1185914487 -10 Left 1185914483 X:4021070-4021092 CCATCCTCATGACGGAGTCCTGG No data
Right 1185914487 X:4021083-4021105 GGAGTCCTGGAGAAAGCCCAGGG No data
1185914483_1185914491 18 Left 1185914483 X:4021070-4021092 CCATCCTCATGACGGAGTCCTGG No data
Right 1185914491 X:4021111-4021133 TCAATTCCCAAGTGTCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185914483 Original CRISPR CCAGGACTCCGTCATGAGGA TGG (reversed) Intergenic