ID: 1185914485

View in Genome Browser
Species Human (GRCh38)
Location X:4021074-4021096
Sequence TTCTCCAGGACTCCGTCATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185914485_1185914491 14 Left 1185914485 X:4021074-4021096 CCTCATGACGGAGTCCTGGAGAA No data
Right 1185914491 X:4021111-4021133 TCAATTCCCAAGTGTCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185914485 Original CRISPR TTCTCCAGGACTCCGTCATG AGG (reversed) Intergenic