ID: 1185914487

View in Genome Browser
Species Human (GRCh38)
Location X:4021083-4021105
Sequence GGAGTCCTGGAGAAAGCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185914479_1185914487 25 Left 1185914479 X:4021035-4021057 CCATTCAGCAGGGTGACGTCTTC No data
Right 1185914487 X:4021083-4021105 GGAGTCCTGGAGAAAGCCCAGGG No data
1185914483_1185914487 -10 Left 1185914483 X:4021070-4021092 CCATCCTCATGACGGAGTCCTGG No data
Right 1185914487 X:4021083-4021105 GGAGTCCTGGAGAAAGCCCAGGG No data
1185914481_1185914487 -2 Left 1185914481 X:4021062-4021084 CCTCTGCACCATCCTCATGACGG No data
Right 1185914487 X:4021083-4021105 GGAGTCCTGGAGAAAGCCCAGGG No data
1185914480_1185914487 3 Left 1185914480 X:4021057-4021079 CCAGTCCTCTGCACCATCCTCAT No data
Right 1185914487 X:4021083-4021105 GGAGTCCTGGAGAAAGCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185914487 Original CRISPR GGAGTCCTGGAGAAAGCCCA GGG Intergenic