ID: 1185914488

View in Genome Browser
Species Human (GRCh38)
Location X:4021088-4021110
Sequence CTACACCCTGGGCTTTCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185914488_1185914494 22 Left 1185914488 X:4021088-4021110 CCTGGAGAAAGCCCAGGGTGTAG No data
Right 1185914494 X:4021133-4021155 GTCTCTACTCTCACCCTCCCTGG No data
1185914488_1185914491 0 Left 1185914488 X:4021088-4021110 CCTGGAGAAAGCCCAGGGTGTAG No data
Right 1185914491 X:4021111-4021133 TCAATTCCCAAGTGTCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185914488 Original CRISPR CTACACCCTGGGCTTTCTCC AGG (reversed) Intergenic