ID: 1185914491

View in Genome Browser
Species Human (GRCh38)
Location X:4021111-4021133
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185914485_1185914491 14 Left 1185914485 X:4021074-4021096 CCTCATGACGGAGTCCTGGAGAA No data
Right 1185914491 X:4021111-4021133 TCAATTCCCAAGTGTCATCTTGG No data
1185914488_1185914491 0 Left 1185914488 X:4021088-4021110 CCTGGAGAAAGCCCAGGGTGTAG No data
Right 1185914491 X:4021111-4021133 TCAATTCCCAAGTGTCATCTTGG No data
1185914481_1185914491 26 Left 1185914481 X:4021062-4021084 CCTCTGCACCATCCTCATGACGG No data
Right 1185914491 X:4021111-4021133 TCAATTCCCAAGTGTCATCTTGG No data
1185914483_1185914491 18 Left 1185914483 X:4021070-4021092 CCATCCTCATGACGGAGTCCTGG No data
Right 1185914491 X:4021111-4021133 TCAATTCCCAAGTGTCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185914491 Original CRISPR TCAATTCCCAAGTGTCATCT TGG Intergenic