ID: 1185914494

View in Genome Browser
Species Human (GRCh38)
Location X:4021133-4021155
Sequence GTCTCTACTCTCACCCTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185914490_1185914494 10 Left 1185914490 X:4021100-4021122 CCAGGGTGTAGTCAATTCCCAAG No data
Right 1185914494 X:4021133-4021155 GTCTCTACTCTCACCCTCCCTGG No data
1185914488_1185914494 22 Left 1185914488 X:4021088-4021110 CCTGGAGAAAGCCCAGGGTGTAG No data
Right 1185914494 X:4021133-4021155 GTCTCTACTCTCACCCTCCCTGG No data
1185914493_1185914494 -8 Left 1185914493 X:4021118-4021140 CCAAGTGTCATCTTGGTCTCTAC No data
Right 1185914494 X:4021133-4021155 GTCTCTACTCTCACCCTCCCTGG No data
1185914489_1185914494 11 Left 1185914489 X:4021099-4021121 CCCAGGGTGTAGTCAATTCCCAA No data
Right 1185914494 X:4021133-4021155 GTCTCTACTCTCACCCTCCCTGG No data
1185914492_1185914494 -7 Left 1185914492 X:4021117-4021139 CCCAAGTGTCATCTTGGTCTCTA No data
Right 1185914494 X:4021133-4021155 GTCTCTACTCTCACCCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185914494 Original CRISPR GTCTCTACTCTCACCCTCCC TGG Intergenic