ID: 1185915386

View in Genome Browser
Species Human (GRCh38)
Location X:4028779-4028801
Sequence AACAAACACTGCCTTGTTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185915386_1185915391 15 Left 1185915386 X:4028779-4028801 CCAAAAACAAGGCAGTGTTTGTT No data
Right 1185915391 X:4028817-4028839 TGCTCACGATTAGGGCTGCCAGG No data
1185915386_1185915390 7 Left 1185915386 X:4028779-4028801 CCAAAAACAAGGCAGTGTTTGTT No data
Right 1185915390 X:4028809-4028831 GATATGCATGCTCACGATTAGGG No data
1185915386_1185915389 6 Left 1185915386 X:4028779-4028801 CCAAAAACAAGGCAGTGTTTGTT No data
Right 1185915389 X:4028808-4028830 GGATATGCATGCTCACGATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185915386 Original CRISPR AACAAACACTGCCTTGTTTT TGG (reversed) Intergenic
No off target data available for this crispr