ID: 1185915391

View in Genome Browser
Species Human (GRCh38)
Location X:4028817-4028839
Sequence TGCTCACGATTAGGGCTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185915386_1185915391 15 Left 1185915386 X:4028779-4028801 CCAAAAACAAGGCAGTGTTTGTT No data
Right 1185915391 X:4028817-4028839 TGCTCACGATTAGGGCTGCCAGG No data
1185915388_1185915391 -9 Left 1185915388 X:4028803-4028825 CCAGTGGATATGCATGCTCACGA No data
Right 1185915391 X:4028817-4028839 TGCTCACGATTAGGGCTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185915391 Original CRISPR TGCTCACGATTAGGGCTGCC AGG Intergenic
No off target data available for this crispr