ID: 1185922771

View in Genome Browser
Species Human (GRCh38)
Location X:4112622-4112644
Sequence ACATATTGAGTACCCTGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185922771_1185922773 14 Left 1185922771 X:4112622-4112644 CCTCCTCAGGGTACTCAATATGT No data
Right 1185922773 X:4112659-4112681 GAGCTTAGATTGTCTCACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185922771 Original CRISPR ACATATTGAGTACCCTGAGG AGG (reversed) Intergenic
No off target data available for this crispr