ID: 1185925089

View in Genome Browser
Species Human (GRCh38)
Location X:4136985-4137007
Sequence AACCCGAAGTGTGTCTTGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185925087_1185925089 -9 Left 1185925087 X:4136971-4136993 CCCTTTTCTAATCTAACCCGAAG No data
Right 1185925089 X:4136985-4137007 AACCCGAAGTGTGTCTTGAGTGG No data
1185925086_1185925089 26 Left 1185925086 X:4136936-4136958 CCATGATGACGGGGTGTGGCTGT No data
Right 1185925089 X:4136985-4137007 AACCCGAAGTGTGTCTTGAGTGG No data
1185925088_1185925089 -10 Left 1185925088 X:4136972-4136994 CCTTTTCTAATCTAACCCGAAGT No data
Right 1185925089 X:4136985-4137007 AACCCGAAGTGTGTCTTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185925089 Original CRISPR AACCCGAAGTGTGTCTTGAG TGG Intergenic
No off target data available for this crispr