ID: 1185925089 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:4136985-4137007 |
| Sequence | AACCCGAAGTGTGTCTTGAG TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1185925087_1185925089 | -9 | Left | 1185925087 | X:4136971-4136993 | CCCTTTTCTAATCTAACCCGAAG | No data | ||
| Right | 1185925089 | X:4136985-4137007 | AACCCGAAGTGTGTCTTGAGTGG | No data | ||||
| 1185925086_1185925089 | 26 | Left | 1185925086 | X:4136936-4136958 | CCATGATGACGGGGTGTGGCTGT | No data | ||
| Right | 1185925089 | X:4136985-4137007 | AACCCGAAGTGTGTCTTGAGTGG | No data | ||||
| 1185925088_1185925089 | -10 | Left | 1185925088 | X:4136972-4136994 | CCTTTTCTAATCTAACCCGAAGT | No data | ||
| Right | 1185925089 | X:4136985-4137007 | AACCCGAAGTGTGTCTTGAGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1185925089 | Original CRISPR | AACCCGAAGTGTGTCTTGAG TGG | Intergenic | ||
| No off target data available for this crispr | |||||