ID: 1185926986

View in Genome Browser
Species Human (GRCh38)
Location X:4158115-4158137
Sequence GAATCACTATATCAAAATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185926986_1185926987 4 Left 1185926986 X:4158115-4158137 CCATGATTTTGATATAGTGATTC No data
Right 1185926987 X:4158142-4158164 AACTATATGATATAGATGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185926986 Original CRISPR GAATCACTATATCAAAATCA TGG (reversed) Intergenic
No off target data available for this crispr