ID: 1185927066

View in Genome Browser
Species Human (GRCh38)
Location X:4158883-4158905
Sequence CCCCCTGAAAGGTGATCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185927066_1185927072 8 Left 1185927066 X:4158883-4158905 CCAGGAGATCACCTTTCAGGGGG No data
Right 1185927072 X:4158914-4158936 AAGGTGAGACCTCTCTCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185927066 Original CRISPR CCCCCTGAAAGGTGATCTCC TGG (reversed) Intergenic
No off target data available for this crispr