ID: 1185930447

View in Genome Browser
Species Human (GRCh38)
Location X:4197042-4197064
Sequence ATACACTCCTGGGATAAATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185930447_1185930456 26 Left 1185930447 X:4197042-4197064 CCACATTTATCCCAGGAGTGTAT No data
Right 1185930456 X:4197091-4197113 CTATGTTTAGACATGCCATGGGG No data
1185930447_1185930455 25 Left 1185930447 X:4197042-4197064 CCACATTTATCCCAGGAGTGTAT No data
Right 1185930455 X:4197090-4197112 ACTATGTTTAGACATGCCATGGG No data
1185930447_1185930454 24 Left 1185930447 X:4197042-4197064 CCACATTTATCCCAGGAGTGTAT No data
Right 1185930454 X:4197089-4197111 CACTATGTTTAGACATGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185930447 Original CRISPR ATACACTCCTGGGATAAATG TGG (reversed) Intergenic
No off target data available for this crispr