ID: 1185933727

View in Genome Browser
Species Human (GRCh38)
Location X:4232239-4232261
Sequence CTGTACATAAAGATGAAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185933727_1185933731 15 Left 1185933727 X:4232239-4232261 CCATTCTTCATCTTTATGTACAG No data
Right 1185933731 X:4232277-4232299 TTTAGCTAAATGGGCCCTTCTGG No data
1185933727_1185933728 5 Left 1185933727 X:4232239-4232261 CCATTCTTCATCTTTATGTACAG No data
Right 1185933728 X:4232267-4232289 CAAAAACCATTTTAGCTAAATGG No data
1185933727_1185933729 6 Left 1185933727 X:4232239-4232261 CCATTCTTCATCTTTATGTACAG No data
Right 1185933729 X:4232268-4232290 AAAAACCATTTTAGCTAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185933727 Original CRISPR CTGTACATAAAGATGAAGAA TGG (reversed) Intergenic
No off target data available for this crispr