ID: 1185934198

View in Genome Browser
Species Human (GRCh38)
Location X:4237210-4237232
Sequence CACCCACTCTGCTCCTTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185934198_1185934203 19 Left 1185934198 X:4237210-4237232 CCCTCCAAGGAGCAGAGTGGGTG No data
Right 1185934203 X:4237252-4237274 TGTCTGAACTTCACTGTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185934198 Original CRISPR CACCCACTCTGCTCCTTGGA GGG (reversed) Intergenic
No off target data available for this crispr