ID: 1185934203

View in Genome Browser
Species Human (GRCh38)
Location X:4237252-4237274
Sequence TGTCTGAACTTCACTGTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185934199_1185934203 18 Left 1185934199 X:4237211-4237233 CCTCCAAGGAGCAGAGTGGGTGT No data
Right 1185934203 X:4237252-4237274 TGTCTGAACTTCACTGTGTCTGG No data
1185934200_1185934203 15 Left 1185934200 X:4237214-4237236 CCAAGGAGCAGAGTGGGTGTCAG No data
Right 1185934203 X:4237252-4237274 TGTCTGAACTTCACTGTGTCTGG No data
1185934198_1185934203 19 Left 1185934198 X:4237210-4237232 CCCTCCAAGGAGCAGAGTGGGTG No data
Right 1185934203 X:4237252-4237274 TGTCTGAACTTCACTGTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185934203 Original CRISPR TGTCTGAACTTCACTGTGTC TGG Intergenic
No off target data available for this crispr