ID: 1185935933

View in Genome Browser
Species Human (GRCh38)
Location X:4257282-4257304
Sequence CATGAGAGGGAGGCCAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185935923_1185935933 25 Left 1185935923 X:4257234-4257256 CCAGCCTCTTGCTGCTTCAGCCA No data
Right 1185935933 X:4257282-4257304 CATGAGAGGGAGGCCAAGGAAGG No data
1185935927_1185935933 5 Left 1185935927 X:4257254-4257276 CCACTTCTGAACTTTGGGCACCG No data
Right 1185935933 X:4257282-4257304 CATGAGAGGGAGGCCAAGGAAGG No data
1185935924_1185935933 21 Left 1185935924 X:4257238-4257260 CCTCTTGCTGCTTCAGCCACTTC No data
Right 1185935933 X:4257282-4257304 CATGAGAGGGAGGCCAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185935933 Original CRISPR CATGAGAGGGAGGCCAAGGA AGG Intergenic
No off target data available for this crispr