ID: 1185936159

View in Genome Browser
Species Human (GRCh38)
Location X:4258662-4258684
Sequence ATGTAGAGAAGGAGAGCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185936159_1185936162 29 Left 1185936159 X:4258662-4258684 CCATCAGCTCTCCTTCTCTACAT No data
Right 1185936162 X:4258714-4258736 TATGCCACGAAGTAAATATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185936159 Original CRISPR ATGTAGAGAAGGAGAGCTGA TGG (reversed) Intergenic
No off target data available for this crispr