ID: 1185943957

View in Genome Browser
Species Human (GRCh38)
Location X:4353641-4353663
Sequence TCAGCCCTCAACCCCCTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185943957_1185943967 6 Left 1185943957 X:4353641-4353663 CCCTCAAGGGGGTTGAGGGCTGA No data
Right 1185943967 X:4353670-4353692 TGCCCTGGGCTGGGCGGGCTGGG No data
1185943957_1185943971 22 Left 1185943957 X:4353641-4353663 CCCTCAAGGGGGTTGAGGGCTGA No data
Right 1185943971 X:4353686-4353708 GGCTGGGAGGTTATCTGAGATGG No data
1185943957_1185943963 0 Left 1185943957 X:4353641-4353663 CCCTCAAGGGGGTTGAGGGCTGA No data
Right 1185943963 X:4353664-4353686 ACCTTGTGCCCTGGGCTGGGCGG No data
1185943957_1185943960 -8 Left 1185943957 X:4353641-4353663 CCCTCAAGGGGGTTGAGGGCTGA No data
Right 1185943960 X:4353656-4353678 AGGGCTGAACCTTGTGCCCTGGG No data
1185943957_1185943965 1 Left 1185943957 X:4353641-4353663 CCCTCAAGGGGGTTGAGGGCTGA No data
Right 1185943965 X:4353665-4353687 CCTTGTGCCCTGGGCTGGGCGGG No data
1185943957_1185943962 -3 Left 1185943957 X:4353641-4353663 CCCTCAAGGGGGTTGAGGGCTGA No data
Right 1185943962 X:4353661-4353683 TGAACCTTGTGCCCTGGGCTGGG No data
1185943957_1185943966 5 Left 1185943957 X:4353641-4353663 CCCTCAAGGGGGTTGAGGGCTGA No data
Right 1185943966 X:4353669-4353691 GTGCCCTGGGCTGGGCGGGCTGG No data
1185943957_1185943959 -9 Left 1185943957 X:4353641-4353663 CCCTCAAGGGGGTTGAGGGCTGA No data
Right 1185943959 X:4353655-4353677 GAGGGCTGAACCTTGTGCCCTGG No data
1185943957_1185943961 -4 Left 1185943957 X:4353641-4353663 CCCTCAAGGGGGTTGAGGGCTGA No data
Right 1185943961 X:4353660-4353682 CTGAACCTTGTGCCCTGGGCTGG No data
1185943957_1185943970 9 Left 1185943957 X:4353641-4353663 CCCTCAAGGGGGTTGAGGGCTGA No data
Right 1185943970 X:4353673-4353695 CCTGGGCTGGGCGGGCTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185943957 Original CRISPR TCAGCCCTCAACCCCCTTGA GGG (reversed) Intergenic
No off target data available for this crispr