ID: 1185953045

View in Genome Browser
Species Human (GRCh38)
Location X:4457694-4457716
Sequence CTAAATTTACCCAGTGAGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185953045_1185953049 21 Left 1185953045 X:4457694-4457716 CCGTCCTCACTGGGTAAATTTAG No data
Right 1185953049 X:4457738-4457760 GAGAGAGCTCAATCCTTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185953045 Original CRISPR CTAAATTTACCCAGTGAGGA CGG (reversed) Intergenic
No off target data available for this crispr