ID: 1185953152

View in Genome Browser
Species Human (GRCh38)
Location X:4458589-4458611
Sequence CCGTCAGACCTGAAGGTACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185953152_1185953156 19 Left 1185953152 X:4458589-4458611 CCCTGTACCTTCAGGTCTGACGG No data
Right 1185953156 X:4458631-4458653 TACAATATGCCTAGCAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185953152 Original CRISPR CCGTCAGACCTGAAGGTACA GGG (reversed) Intergenic
No off target data available for this crispr