ID: 1185954704

View in Genome Browser
Species Human (GRCh38)
Location X:4476979-4477001
Sequence CTGTAGGAAGAATCCATCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185954698_1185954704 -1 Left 1185954698 X:4476957-4476979 CCCAATGAGTCATATCCCTAACC No data
Right 1185954704 X:4476979-4477001 CTGTAGGAAGAATCCATCAGTGG No data
1185954697_1185954704 0 Left 1185954697 X:4476956-4476978 CCCCAATGAGTCATATCCCTAAC No data
Right 1185954704 X:4476979-4477001 CTGTAGGAAGAATCCATCAGTGG No data
1185954696_1185954704 3 Left 1185954696 X:4476953-4476975 CCACCCCAATGAGTCATATCCCT No data
Right 1185954704 X:4476979-4477001 CTGTAGGAAGAATCCATCAGTGG No data
1185954699_1185954704 -2 Left 1185954699 X:4476958-4476980 CCAATGAGTCATATCCCTAACCT No data
Right 1185954704 X:4476979-4477001 CTGTAGGAAGAATCCATCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185954704 Original CRISPR CTGTAGGAAGAATCCATCAG TGG Intergenic
No off target data available for this crispr