ID: 1185956261

View in Genome Browser
Species Human (GRCh38)
Location X:4494261-4494283
Sequence CTGTGATCAAGGAGCAACTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185956257_1185956261 -2 Left 1185956257 X:4494240-4494262 CCTTCTGGGTCGTTACCTGTTCT No data
Right 1185956261 X:4494261-4494283 CTGTGATCAAGGAGCAACTAGGG No data
1185956253_1185956261 26 Left 1185956253 X:4494212-4494234 CCACAAGGCACATTGAACTGCAC No data
Right 1185956261 X:4494261-4494283 CTGTGATCAAGGAGCAACTAGGG No data
1185956256_1185956261 4 Left 1185956256 X:4494234-4494256 CCTGCACCTTCTGGGTCGTTACC No data
Right 1185956261 X:4494261-4494283 CTGTGATCAAGGAGCAACTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185956261 Original CRISPR CTGTGATCAAGGAGCAACTA GGG Intergenic
No off target data available for this crispr