ID: 1185961919

View in Genome Browser
Species Human (GRCh38)
Location X:4553747-4553769
Sequence GAGAATGCTCAAATGCAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185961918_1185961919 -7 Left 1185961918 X:4553731-4553753 CCTCGGTCACACAACAGAGAATG No data
Right 1185961919 X:4553747-4553769 GAGAATGCTCAAATGCAGATTGG No data
1185961915_1185961919 22 Left 1185961915 X:4553702-4553724 CCAAAGCTCATAATGGGTTGACC No data
Right 1185961919 X:4553747-4553769 GAGAATGCTCAAATGCAGATTGG No data
1185961917_1185961919 1 Left 1185961917 X:4553723-4553745 CCACACGTCCTCGGTCACACAAC No data
Right 1185961919 X:4553747-4553769 GAGAATGCTCAAATGCAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185961919 Original CRISPR GAGAATGCTCAAATGCAGAT TGG Intergenic
No off target data available for this crispr