ID: 1185966525

View in Genome Browser
Species Human (GRCh38)
Location X:4611795-4611817
Sequence TGTCTAATGCTGAAATTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185966524_1185966525 25 Left 1185966524 X:4611747-4611769 CCATACACAGGCTTTAGTGTGGA No data
Right 1185966525 X:4611795-4611817 TGTCTAATGCTGAAATTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185966525 Original CRISPR TGTCTAATGCTGAAATTGCA AGG Intergenic
No off target data available for this crispr