ID: 1185969601

View in Genome Browser
Species Human (GRCh38)
Location X:4647811-4647833
Sequence GTGTAGTGGGAGGAGTTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185969601_1185969610 16 Left 1185969601 X:4647811-4647833 CCCACCAACTCCTCCCACTACAC No data
Right 1185969610 X:4647850-4647872 GTACAATTCAAGATGATATTTGG 0: 20
1: 714
2: 7657
3: 10878
4: 10217
1185969601_1185969611 17 Left 1185969601 X:4647811-4647833 CCCACCAACTCCTCCCACTACAC No data
Right 1185969611 X:4647851-4647873 TACAATTCAAGATGATATTTGGG 0: 147
1: 7497
2: 10753
3: 9409
4: 7919
1185969601_1185969612 20 Left 1185969601 X:4647811-4647833 CCCACCAACTCCTCCCACTACAC No data
Right 1185969612 X:4647854-4647876 AATTCAAGATGATATTTGGGTGG 0: 190
1: 8210
2: 11478
3: 9673
4: 8592

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185969601 Original CRISPR GTGTAGTGGGAGGAGTTGGT GGG (reversed) Intergenic
No off target data available for this crispr