ID: 1185970632

View in Genome Browser
Species Human (GRCh38)
Location X:4658643-4658665
Sequence AGAATCCAGCCACATGCAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185970632_1185970635 13 Left 1185970632 X:4658643-4658665 CCAGTTGCATGTGGCTGGATTCT No data
Right 1185970635 X:4658679-4658701 TGCCCTCAATAAGCCTGGGTTGG No data
1185970632_1185970636 14 Left 1185970632 X:4658643-4658665 CCAGTTGCATGTGGCTGGATTCT No data
Right 1185970636 X:4658680-4658702 GCCCTCAATAAGCCTGGGTTGGG No data
1185970632_1185970640 28 Left 1185970632 X:4658643-4658665 CCAGTTGCATGTGGCTGGATTCT No data
Right 1185970640 X:4658694-4658716 TGGGTTGGGCTCTTAACTGCAGG No data
1185970632_1185970634 9 Left 1185970632 X:4658643-4658665 CCAGTTGCATGTGGCTGGATTCT No data
Right 1185970634 X:4658675-4658697 GTCTTGCCCTCAATAAGCCTGGG No data
1185970632_1185970633 8 Left 1185970632 X:4658643-4658665 CCAGTTGCATGTGGCTGGATTCT No data
Right 1185970633 X:4658674-4658696 AGTCTTGCCCTCAATAAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185970632 Original CRISPR AGAATCCAGCCACATGCAAC TGG (reversed) Intergenic