ID: 1185970635

View in Genome Browser
Species Human (GRCh38)
Location X:4658679-4658701
Sequence TGCCCTCAATAAGCCTGGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185970632_1185970635 13 Left 1185970632 X:4658643-4658665 CCAGTTGCATGTGGCTGGATTCT No data
Right 1185970635 X:4658679-4658701 TGCCCTCAATAAGCCTGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185970635 Original CRISPR TGCCCTCAATAAGCCTGGGT TGG Intergenic