ID: 1185973850

View in Genome Browser
Species Human (GRCh38)
Location X:4696058-4696080
Sequence GCCCATTTTGACCACGTTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185973850_1185973852 24 Left 1185973850 X:4696058-4696080 CCATGAACGTGGTCAAAATGGGC No data
Right 1185973852 X:4696105-4696127 TACAATAGGAAATATGTATGTGG No data
1185973850_1185973851 10 Left 1185973850 X:4696058-4696080 CCATGAACGTGGTCAAAATGGGC No data
Right 1185973851 X:4696091-4696113 CAAATAAATACAGATACAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185973850 Original CRISPR GCCCATTTTGACCACGTTCA TGG (reversed) Intergenic