ID: 1185973851

View in Genome Browser
Species Human (GRCh38)
Location X:4696091-4696113
Sequence CAAATAAATACAGATACAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185973850_1185973851 10 Left 1185973850 X:4696058-4696080 CCATGAACGTGGTCAAAATGGGC No data
Right 1185973851 X:4696091-4696113 CAAATAAATACAGATACAATAGG No data
1185973848_1185973851 11 Left 1185973848 X:4696057-4696079 CCCATGAACGTGGTCAAAATGGG No data
Right 1185973851 X:4696091-4696113 CAAATAAATACAGATACAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185973851 Original CRISPR CAAATAAATACAGATACAAT AGG Intergenic
No off target data available for this crispr