ID: 1185973851 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | X:4696091-4696113 |
Sequence | CAAATAAATACAGATACAAT AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1185973850_1185973851 | 10 | Left | 1185973850 | X:4696058-4696080 | CCATGAACGTGGTCAAAATGGGC | No data | ||
Right | 1185973851 | X:4696091-4696113 | CAAATAAATACAGATACAATAGG | No data | ||||
1185973848_1185973851 | 11 | Left | 1185973848 | X:4696057-4696079 | CCCATGAACGTGGTCAAAATGGG | No data | ||
Right | 1185973851 | X:4696091-4696113 | CAAATAAATACAGATACAATAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1185973851 | Original CRISPR | CAAATAAATACAGATACAAT AGG | Intergenic | ||