ID: 1185981136

View in Genome Browser
Species Human (GRCh38)
Location X:4780143-4780165
Sequence GTGAATACACAGTTGAAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185981132_1185981136 18 Left 1185981132 X:4780102-4780124 CCTGGACACTTCCTAACTTTTCA No data
Right 1185981136 X:4780143-4780165 GTGAATACACAGTTGAAGCTTGG No data
1185981134_1185981136 7 Left 1185981134 X:4780113-4780135 CCTAACTTTTCACAAGGCTGTGG No data
Right 1185981136 X:4780143-4780165 GTGAATACACAGTTGAAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185981136 Original CRISPR GTGAATACACAGTTGAAGCT TGG Intergenic
No off target data available for this crispr