ID: 1185990230

View in Genome Browser
Species Human (GRCh38)
Location X:4886953-4886975
Sequence GTTTCTTATTTATTAAAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185990230_1185990234 26 Left 1185990230 X:4886953-4886975 CCATGCTTTAATAAATAAGAAAC No data
Right 1185990234 X:4887002-4887024 TGAAAGAGATGACTGATAGTGGG No data
1185990230_1185990233 25 Left 1185990230 X:4886953-4886975 CCATGCTTTAATAAATAAGAAAC No data
Right 1185990233 X:4887001-4887023 CTGAAAGAGATGACTGATAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185990230 Original CRISPR GTTTCTTATTTATTAAAGCA TGG (reversed) Intergenic
No off target data available for this crispr