ID: 1185996445

View in Genome Browser
Species Human (GRCh38)
Location X:4955370-4955392
Sequence ACTCATGAAAACCAACATTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185996445_1185996446 2 Left 1185996445 X:4955370-4955392 CCACAATGTTGGTTTTCATGAGT No data
Right 1185996446 X:4955395-4955417 ACATAGTAATCTCCATGCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185996445 Original CRISPR ACTCATGAAAACCAACATTG TGG (reversed) Intergenic
No off target data available for this crispr