ID: 1185999633

View in Genome Browser
Species Human (GRCh38)
Location X:4993963-4993985
Sequence ACTCAAGTTCTGCAGGAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185999630_1185999633 0 Left 1185999630 X:4993940-4993962 CCAGGTGATTGAATTTGGACCAG No data
Right 1185999633 X:4993963-4993985 ACTCAAGTTCTGCAGGAACATGG No data
1185999626_1185999633 25 Left 1185999626 X:4993915-4993937 CCACTGGGGGACATTACACCTGC No data
Right 1185999633 X:4993963-4993985 ACTCAAGTTCTGCAGGAACATGG No data
1185999628_1185999633 7 Left 1185999628 X:4993933-4993955 CCTGCATCCAGGTGATTGAATTT No data
Right 1185999633 X:4993963-4993985 ACTCAAGTTCTGCAGGAACATGG No data
1185999625_1185999633 30 Left 1185999625 X:4993910-4993932 CCATTCCACTGGGGGACATTACA No data
Right 1185999633 X:4993963-4993985 ACTCAAGTTCTGCAGGAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185999633 Original CRISPR ACTCAAGTTCTGCAGGAACA TGG Intergenic
No off target data available for this crispr