ID: 1186008687

View in Genome Browser
Species Human (GRCh38)
Location X:5104765-5104787
Sequence AATTAACTAGTGTCTTGCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186008687_1186008693 29 Left 1186008687 X:5104765-5104787 CCAAAGCAAGACACTAGTTAATT No data
Right 1186008693 X:5104817-5104839 GCAGATATTTATATTTCTGTGGG No data
1186008687_1186008692 28 Left 1186008687 X:5104765-5104787 CCAAAGCAAGACACTAGTTAATT No data
Right 1186008692 X:5104816-5104838 TGCAGATATTTATATTTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186008687 Original CRISPR AATTAACTAGTGTCTTGCTT TGG (reversed) Intergenic
No off target data available for this crispr