ID: 1186012725

View in Genome Browser
Species Human (GRCh38)
Location X:5153977-5153999
Sequence GACCAATGTTTGGCTGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186012721_1186012725 28 Left 1186012721 X:5153926-5153948 CCATTCATCTAAAATTCTAAGAA No data
Right 1186012725 X:5153977-5153999 GACCAATGTTTGGCTGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186012725 Original CRISPR GACCAATGTTTGGCTGCTGC TGG Intergenic
No off target data available for this crispr