ID: 1186017089

View in Genome Browser
Species Human (GRCh38)
Location X:5209610-5209632
Sequence CTTCATATCAATAAGCAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186017088_1186017089 -8 Left 1186017088 X:5209595-5209617 CCTAAGTTTGATTAACTTCATAT No data
Right 1186017089 X:5209610-5209632 CTTCATATCAATAAGCAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186017089 Original CRISPR CTTCATATCAATAAGCAAGC AGG Intergenic
No off target data available for this crispr