ID: 1186017818

View in Genome Browser
Species Human (GRCh38)
Location X:5217994-5218016
Sequence AGGGGTAGAGAGAAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186017810_1186017818 18 Left 1186017810 X:5217953-5217975 CCAGACTGAGCAACAGGGCAAGA No data
Right 1186017818 X:5217994-5218016 AGGGGTAGAGAGAAGGAGGAGGG No data
1186017807_1186017818 28 Left 1186017807 X:5217943-5217965 CCACTGTACTCCAGACTGAGCAA 0: 8
1: 465
2: 11008
3: 95373
4: 205859
Right 1186017818 X:5217994-5218016 AGGGGTAGAGAGAAGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186017818 Original CRISPR AGGGGTAGAGAGAAGGAGGA GGG Intergenic
No off target data available for this crispr