ID: 1186024650

View in Genome Browser
Species Human (GRCh38)
Location X:5296033-5296055
Sequence ATTTGGAAGACGAAGGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186024642_1186024650 11 Left 1186024642 X:5295999-5296021 CCAAGGATGATGGCTCACACCTG No data
Right 1186024650 X:5296033-5296055 ATTTGGAAGACGAAGGTGGGAGG No data
1186024644_1186024650 -8 Left 1186024644 X:5296018-5296040 CCTGTAATCCCAGCAATTTGGAA 0: 117
1: 14065
2: 325362
3: 327081
4: 297721
Right 1186024650 X:5296033-5296055 ATTTGGAAGACGAAGGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186024650 Original CRISPR ATTTGGAAGACGAAGGTGGG AGG Intergenic
No off target data available for this crispr