ID: 1186025047

View in Genome Browser
Species Human (GRCh38)
Location X:5300147-5300169
Sequence GCTCAAATCACACAGCTAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186025047_1186025048 -8 Left 1186025047 X:5300147-5300169 CCTGCTAGCTGTGTGATTTGAGC No data
Right 1186025048 X:5300162-5300184 ATTTGAGCAATTTAGTAACTAGG No data
1186025047_1186025050 20 Left 1186025047 X:5300147-5300169 CCTGCTAGCTGTGTGATTTGAGC No data
Right 1186025050 X:5300190-5300212 GATTTTCATTTTATGAATTAGGG No data
1186025047_1186025049 19 Left 1186025047 X:5300147-5300169 CCTGCTAGCTGTGTGATTTGAGC No data
Right 1186025049 X:5300189-5300211 AGATTTTCATTTTATGAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186025047 Original CRISPR GCTCAAATCACACAGCTAGC AGG (reversed) Intergenic
No off target data available for this crispr