ID: 1186025048

View in Genome Browser
Species Human (GRCh38)
Location X:5300162-5300184
Sequence ATTTGAGCAATTTAGTAACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186025047_1186025048 -8 Left 1186025047 X:5300147-5300169 CCTGCTAGCTGTGTGATTTGAGC No data
Right 1186025048 X:5300162-5300184 ATTTGAGCAATTTAGTAACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186025048 Original CRISPR ATTTGAGCAATTTAGTAACT AGG Intergenic
No off target data available for this crispr