ID: 1186030650

View in Genome Browser
Species Human (GRCh38)
Location X:5365766-5365788
Sequence CTATGTCCTTTCCAAGATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186030648_1186030650 1 Left 1186030648 X:5365742-5365764 CCAAGGGGAAGGAATCATGCCTG No data
Right 1186030650 X:5365766-5365788 CTATGTCCTTTCCAAGATGCTGG No data
1186030646_1186030650 9 Left 1186030646 X:5365734-5365756 CCACAATCCCAAGGGGAAGGAAT No data
Right 1186030650 X:5365766-5365788 CTATGTCCTTTCCAAGATGCTGG No data
1186030647_1186030650 2 Left 1186030647 X:5365741-5365763 CCCAAGGGGAAGGAATCATGCCT No data
Right 1186030650 X:5365766-5365788 CTATGTCCTTTCCAAGATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186030650 Original CRISPR CTATGTCCTTTCCAAGATGC TGG Intergenic
No off target data available for this crispr