ID: 1186031590

View in Genome Browser
Species Human (GRCh38)
Location X:5374917-5374939
Sequence GCCACACAAATGTCCACTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186031590_1186031592 -10 Left 1186031590 X:5374917-5374939 CCACCAGTGGACATTTGTGTGGC No data
Right 1186031592 X:5374930-5374952 TTTGTGTGGCTTCCATTTTTTGG No data
1186031590_1186031595 21 Left 1186031590 X:5374917-5374939 CCACCAGTGGACATTTGTGTGGC No data
Right 1186031595 X:5374961-5374983 AATACCTCTGCTATGAACATGGG No data
1186031590_1186031594 20 Left 1186031590 X:5374917-5374939 CCACCAGTGGACATTTGTGTGGC No data
Right 1186031594 X:5374960-5374982 GAATACCTCTGCTATGAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186031590 Original CRISPR GCCACACAAATGTCCACTGG TGG (reversed) Intergenic
No off target data available for this crispr