ID: 1186033141

View in Genome Browser
Species Human (GRCh38)
Location X:5391669-5391691
Sequence CCTACTCTTTCGAGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1186033135_1186033141 22 Left 1186033135 X:5391624-5391646 CCTTACTCTTTATTAAATGTTTA No data
Right 1186033141 X:5391669-5391691 CCTACTCTTTCGAGGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1186033141 Original CRISPR CCTACTCTTTCGAGGGAGGA GGG Intergenic
No off target data available for this crispr